FASTQ format

FASTQ format is a text-based format for storing both a biological sequence (usually nucleotide sequence) and its corresponding quality scores. Both the sequence letter and quality score are each encoded with a single ASCII character for brevity.

It was originally developed at the Wellcome Trust Sanger Institute to bundle a FASTA sequence and its quality data, but has recently become the de facto standard for storing the output of high-throughput sequencing instruments such as the Illumina Genome Analyzer.[1]

Format

A FASTQ file normally uses four lines per sequence.

A FASTQ file containing a single sequence might look like this:

@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65

The character '!' represents the lowest quality while '~' is the highest. Here are the quality value characters in left-to-right increasing order of quality (ASCII):

 !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~

The original Sanger FASTQ files also allowed the sequence and quality strings to be wrapped (split over multiple lines), but this is generally discouraged as it can make parsing complicated due to the unfortunate choice of "@" and "+" as markers (these characters can also occur in the quality string).

Illumina sequence identifiers

Sequences from the Illumina software use a systematic identifier:

@HWUSI-EAS100R:6:73:941:1973#0/1
HWUSI-EAS100R the unique instrument name
6 flowcell lane
73 tile number within the flowcell lane
941 'x'-coordinate of the cluster within the tile
1973 'y'-coordinate of the cluster within the tile
#0 index number for a multiplexed sample (0 for no indexing)
/1 the member of a pair, /1 or /2 (paired-end or mate-pair reads only)

Versions of the Illumina pipeline since 1.4 appear to use #NNNNNN instead of #0 for the multiplex ID, where NNNNNN is the sequence of the multiplex tag.

With Casava 1.8 the format of the '@' line has changed:

@EAS139:136:FC706VJ:2:2104:15343:197393 1:Y:18:ATCACG
EAS139 the unique instrument name
136 the run id
FC706VJ the flowcell id
2 flowcell lane
2104 tile number within the flowcell lane
15343 'x'-coordinate of the cluster within the tile
197393 'y'-coordinate of the cluster within the tile
1 the member of a pair, 1 or 2 (paired-end or mate-pair reads only)
Y Y if the read is filtered, N otherwise
18 0 when none of the control bits are on, otherwise it is an even number
ATCACG index sequence

Note that more recent versions of Illumina software output a sample number (as taken from the sample sheet) in place of an index sequence. For example, the following header might appear in the first sample of a batch:

@EAS139:136:FC706VJ:2:2104:15343:197393 1:N:18:1

NCBI Sequence Read Archive

FASTQ files from the NCBI/EBI Sequence Read Archive often include a description, e.g.

@SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC
+SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC

In this example there is an NCBI-assigned identifier, and the description holds the original identifier from Solexa/Illumina (as described above) plus the read length. Sequencing was performed in paired-end mode (~500bp insert size), see SRR001666. Notably in the above output the paired-end information was lost when the data was extracted from the NCBI SRA using fastq-dump with default settings.

Further to note, with newer fastq-dump the extracted sequences have double-length and it turns out fastq-dump concatenates sequence of the forward and reverse reads together into a non-sense:

$ /opt/sratoolkit.2.5.7-centos_linux64/bin/fastq-dump SRR001666
@SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=72
GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACCAAGTTACCCTTAACAACTTAAGGGTTTTCAAATAGA
+SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=72
IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9ICIIIIIIIIIIIIIIIIIIIIDIIIIIII>IIIIII/
@SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=72
GTTCAGGGATACGACGTTTGTATTTTAAGAATCTGAAGCAGAAGTCGATGATAATACGCGTCGTTTTATCAT
+SRR001666.2 071112_SLXA-EAS1_s_7:5:1:801:338 length=72
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII6IBIIIIIIIIIIIIIIIIIIIIIIIGII>IIIII-I)8I

Better approach is to preserve original accessions and split into two or three files (forward, reverse, singletons), e.g.:

$ /opt/sratoolkit.2.5.7-centos_linux64/bin/fastq-dump --origfmt --split-3 SRR001666
$ head SRR001666_1.fastq  SRR001666_2.fastq
==> SRR001666_1.fastq <==
@071112_SLXA-EAS1_s_7:5:1:817:345
GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC
+071112_SLXA-EAS1_s_7:5:1:817:345
IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC
@071112_SLXA-EAS1_s_7:5:1:801:338
GTTCAGGGATACGACGTTTGTATTTTAAGAATCTGA
+071112_SLXA-EAS1_s_7:5:1:801:338
IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII6IBI

==> SRR001666_2.fastq <==
@071112_SLXA-EAS1_s_7:5:1:817:345
AAGTTACCCTTAACAACTTAAGGGTTTTCAAATAGA
+071112_SLXA-EAS1_s_7:5:1:817:345
IIIIIIIIIIIIIIIIIIIIDIIIIIII>IIIIII/
@071112_SLXA-EAS1_s_7:5:1:801:338
AGCAGAAGTCGATGATAATACGCGTCGTTTTATCAT
+071112_SLXA-EAS1_s_7:5:1:801:338
IIIIIIIIIIIIIIIIIIIIIIGII>IIIII-I)8I

Also note that the NCBI have converted this FASTQ data from the original Solexa/Illumina encoding to the Sanger standard (see encodings below).

Variations

Quality

A quality value Q is an integer mapping of p (i.e., the probability that the corresponding base call is incorrect). Two different equations have been in use. The first is the standard Sanger variant to assess reliability of a base call, otherwise known as Phred quality score:

The Solexa pipeline (i.e., the software delivered with the Illumina Genome Analyzer) earlier used a different mapping, encoding the odds p/(1-p) instead of the probability p:

Although both mappings are asymptotically identical at higher quality values, they differ at lower quality levels (i.e., approximately p > 0.05, or equivalently, Q < 13).

Relationship between Q and p
Relationship between Q and p using the Sanger (red) and Solexa (black) equations (described above). The vertical dotted line indicates p = 0.05, or equivalently, Q ≈ 13.

At times there has been disagreement about which mapping Illumina actually uses. The user guide (Appendix B, page 122) for version 1.4 of the Illumina pipeline states that: "The scores are defined as Q=10*log10(p/(1-p)) [sic], where p is the probability of a base call corresponding to the base in question".[2] In retrospect, this entry in the manual appears to have been an error. The user guide (What's New, page 5) for version 1.5 of the Illumina pipeline lists this description instead: "Important Changes in Pipeline v1.3 [sic]. The quality scoring scheme has changed to the Phred [i.e., Sanger] scoring scheme, encoded as an ASCII character by adding 64 to the Phred value. A Phred score of a base is: , where e is the estimated probability of a base being wrong.[3]

Encoding

@HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
TTAATTGGTAAATAAATCTCCTAATAGCTTAGATNTTACCTTNNNNNNNNNNTAGTTTCTTGAGATTTGTTGGGGGAGACATTTTTGTGATTGCCTTGAT
+HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
efcfffffcfeefffcffffffddf`feed]`]_Ba_^__[YBBBBBBBBBBRTT\]][]dddd`ddd^dddadd^BBBBBBBBBBBBBBBBBBBBBBBB

An alternative interpretation of this ASCII encoding has been proposed.[8] Also, in Illumina runs using PhiX controls, the character 'B' was observed to represent an "unknown quality score". The error rate of 'B' reads was roughly 3 phred scores lower the mean observed score of a given run.

For raw reads, the range of scores will depend on the technology and the base caller used, but will typically be up to 41 for recent Illumina chemistry. Since the maximum observed quality score was previously only 40, various scripts and tools break when they encounter data with quality values larger than 40. For processed reads, scores may be even higher. For example, quality values of 45 are observed in reads from Illumina's Long Read Sequencing Service (previously Moleculo).

  SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS.....................................................
  ..........................XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX......................
  ...............................IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII......................
  .................................JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ......................
  LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL....................................................
  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
  |                         |    |        |                              |                     |
 33                        59   64       73                            104                   126
  0........................26...31.......40                                
                           -5....0........9.............................40 
                                 0........9.............................40 
                                    3.....9.............................40 
  0.2......................26...31........41                              

 S - Sanger        Phred+33,  raw reads typically (0, 40)
 X - Solexa        Solexa+64, raw reads typically (-5, 40)
 I - Illumina 1.3+ Phred+64,  raw reads typically (0, 40)
 J - Illumina 1.5+ Phred+64,  raw reads typically (3, 40)
     with 0=unused, 1=unused, 2=Read Segment Quality Control Indicator (bold) 
     (Note: See discussion above).
 L - Illumina 1.8+ Phred+33,  raw reads typically (0, 41)

Color space

For SOLiD data, the sequence is in color space, except the first position. The quality values are those of the Sanger format. Alignment tools differ in their preferred version of the quality values: some include a quality score (set to 0, i.e. '!') for the leading nucleotide, others do not. The sequence read archive includes this quality score.

Simulation

FASTQ read simulation has been approached by several tools.[9][10] A comparison of those tools can be seen here.[11]

Compression

Quality values account for about half of the required disk space in the FASTQ format (before compression), and therefore the compression of the quality values can significantly reduce storage requirements and speed up analysis and transmission of sequencing data. Both lossless and lossy compression are recently being considered in the literature. For example, the algorithm QualComp [12] performs lossy compression with a rate (number of bits per quality value) specified by the user. Based on rate-distortion theory results, it allocates the number of bits so as to minimize the MSE (mean squared error) between the original (uncompressed) and the reconstructed (after compression) quality values. Other algorithms for compression of quality values include SCALCE [13] and Fastqz.[14] Both are lossless compression algorithms that provide an optional controlled lossy transformation approach. For example, SCALCE reduces the alphabet size based on the observation that “neighboring” quality values are similar in general.

As of the HiSeq 2500 Illumina gives the option to output qualities that have been coarse grained into quality bins. The binned scores are computed directly from the empirical quality score table, which is itself tied to the hardware, software and chemistry that were used during the sequencing experiment.[15]

File extension

There is no standard file extension for a FASTQ file, but .fq and .fastq, are commonly used.

Format converters

Command line conversions

FASTQ to FASTA format:

zcat input_file.fastq.gz | awk 'NR%4==1{printf ">%s\n", substr($0,2)}NR%4==2{print}' > output_file.fa

Illumina FASTQ 1.8 to 1.3

sed -e '4~4y/!"#$%&'\''()*+,-.\/0123456789:;<=>?@ABCDEFGHIJ/@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\\]^_`abcdefghi/' myfile.fastq   # add -i to save the result to the same input file

Illumina FASTQ 1.3 to 1.8

sed -e '4~4y/@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\\]^_`abcdefghi/!"#$%&'\''()*+,-.\/0123456789:;<=>?@ABCDEFGHIJ/' myfile.fastq   # add -i to save the result to the same input file

Illumina FASTQ 1.8 raw quality to binned quality (HiSeq Qtable 2.10.1, HiSeq 4000 )

sed -e '4~4y/!"#$%&'\''()*+,-.\/0123456789:;<=>?@ABCDEFGHIJKL/))))))))))----------77777<<<<<AAAAAFFFFFJJJJ/' myfile.fastq   # add -i to save the result to the same input file

See also

References

  1. ↑ Cock, P. J. A.; Fields, C. J.; Goto, N.; Heuer, M. L.; Rice, P. M. (2009). "The Sanger FASTQ file format for sequences with quality scores, and the Solexa/Illumina FASTQ variants". Nucleic Acids Research. 38 (6): 1767–1771. doi:10.1093/nar/gkp1137. PMC 2847217Freely accessible. PMID 20015970.
  2. ↑ Sequencing Analysis Software User Guide: For Pipeline Version 1.4 and CASAVA Version 1.0, dated April 2009 PDF Archived June 10, 2010, at the Wayback Machine.
  3. ↑ Sequencing Analysis Software User Guide: For Pipeline Version 1.5 and CASAVA Version 1.0, dated August 2009 PDF
  4. ↑ Sequence/Alignment Map format Version 1.0, dated August 2009 PDF
  5. ↑ Seqanswer's topic of skruglyak, dated January 2011 website
  6. ↑ Illumina Quality Scores, Tobias Mann, Bioinformatics, San Diego, Illumina http://seqanswers.com/forums/showthread.php?t=4721
  7. ↑ Using Genome Analyzer Sequencing Control Software, Version 2.6, Catalog # SY-960-2601, Part # 15009921 Rev. A, November 2009 http://watson.nci.nih.gov/solexa/Using_SCSv2.6_15009921_A.pdf[]
  8. ↑ SolexaQA project website
  9. ↑ Huang, W; Li, L; Myers, J. R.; Marth, G. T. (2012). "ART: A next-generation sequencing read simulator". Bioinformatics. 28 (4): 593–4. doi:10.1093/bioinformatics/btr708. PMC 3278762Freely accessible. PMID 22199392.
  10. ↑ Pratas, D; Pinho, A. J.; Rodrigues, J. M. (2014). "XS: A FASTQ read simulator". BMC Research Notes. 7: 40. doi:10.1186/1756-0500-7-40. PMC 3927261Freely accessible. PMID 24433564.
  11. ↑ Escalona, Merly; Rocha, Sara; Posada, David (2016). "A comparison of tools for the simulation of genomic next-generation sequencing data". Nature Reviews Genetics. 17 (8): 459. doi:10.1038/nrg.2016.57. PMID 27320129.
  12. ↑ Ochoa, Idoia; Asnani, Himanshu; Bharadia, Dinesh; Chowdhury, Mainak; Weissman, Tsachy; Yona, Golan (2013). "Qual Comp: A new lossy compressor for quality scores based on rate distortion theory". BMC Bioinformatics. 14: 187. doi:10.1186/1471-2105-14-187. PMC 3698011Freely accessible. PMID 23758828.
  13. ↑ Hach, F; Numanagic, I; Alkan, C; Sahinalp, S. C. (2012). "SCALCE: Boosting sequence compression algorithms using locally consistent encoding". Bioinformatics. 28 (23): 3051–7. doi:10.1093/bioinformatics/bts593. PMC 3509486Freely accessible. PMID 23047557.
  14. ↑ fastqz.http://mattmahoney.net/dc/fastqz/
  15. ↑ Illumina Tech Note.http://www.illumina.com/content/dam/illumina-marketing/documents/products/technotes/technote_understanding_quality_scores.pdf
This article is issued from Wikipedia - version of the 12/3/2016. The text is available under the Creative Commons Attribution/Share Alike but additional terms may apply for the media files.