Telomere

For other uses, see Telomere (disambiguation).
Human chromosomes (grey) capped by telomeres (white)

A telomere is a region of repetitive nucleotide sequences at each end of a chromosome, which protects the end of the chromosome from deterioration or from fusion with neighboring chromosomes. Its name is derived from the Greek nouns telos (τέλος) 'end' and merοs (μέρος, root: μερ-) 'part.' For vertebrates, the sequence of nucleotides in telomeres is TTAGGG, with the complementary DNA strand being AATCCC, with a single-stranded TTAGGG overhang. This sequence of TTAGGG is repeated approximately 2,500 times in humans.[1] In humans, average telomere length declines from about 11 kilobases at birth [2] to less than four kilobases in old age,[3] with average rate of decline being greater in men than in women.[4]

During chromosome replication, the enzymes that duplicate DNA cannot continue their duplication all the way to the end of a chromosome, so in each duplication the end of the chromosome is shortened[5] (this is because the synthesis of Okazaki fragments requires RNA primers attaching ahead on the lagging strand). The telomeres are disposable buffers at the ends of chromosomes which are truncated during cell division; their presence protects the genes before them on the chromosome from being truncated instead. The telomeres themselves are protected by a complex of shelterin proteins, as well as by the RNA that telomeric DNA encodes (TERRA).

Over time, due to each cell division, the telomere ends become shorter.[6] They are replenished by an enzyme, telomerase reverse transcriptase.

Discovery

In the early 1970s, Russian theorist Alexei Olovnikov first recognized that chromosomes could not completely replicate their ends. Building on this, and to accommodate Leonard Hayflick's idea of limited somatic cell division, Olovnikov suggested that DNA sequences are lost every time a cell/DNA replicates until the loss reaches a critical level, at which point cell division ends.[7][8] However, Olovnikov's prediction was not widely known except by a handful of researchers studying cellular aging and immortalization.[9]

In 1975–1977, Elizabeth Blackburn, working as a postdoctoral fellow at Yale University with Joseph Gall, discovered the unusual nature of telomeres, with their simple repeated DNA sequences composing chromosome ends.[10] Blackburn, Carol Greider, and Jack Szostak were awarded the 2009 Nobel Prize in Physiology or Medicine for the discovery of how chromosomes are protected by telomeres and the enzyme telomerase.[11]

Nevertheless, in the 1970s there was no recognition that the telomere-shortening mechanism normally limits cells to a fixed number of divisions, nor was there any animal study suggesting that this could be responsible for aging on the cellular level. There was also no recognition that the mechanism set a limit on lifespans.[12][13]

It remained for a privately funded collaboration from biotechnology company Geron to isolate the genes for the RNA and protein component of human telomerase in order to establish the role of telomere shortening in cellular aging and telomerase reactivation in cell immortalization.[14]

Nature and function

Structure, function and evolutionary biology

loss of genetic material can be caused be telomere shortening.

Telomeres are repetitive nucleotide sequences located at the termini of linear chromosomes of most eukaryotic organisms. For vertebrates, the sequence of nucleotides in telomeres is TTAGGG. Most prokaryotes, lacking this linear arrangement, do not have telomeres. Telomeres compensate for incomplete semi-conservative DNA replication at chromosomal ends. A protein complex known as shelterin serves to protect the ends of telomeres from being recognised as double-strand breaks by inhibiting homologous recombination (HR) and non-homologous end joining (NHEJ).[15][16]

Telomeres are found at the termini of chromosomes. The end of a telomere inserts back into the main body of the telomere to form a T-loop

In most prokaryotes, chromosomes are circular and, thus, do not have ends to suffer premature replication termination. A small fraction of bacterial chromosomes (such as those in Streptomyces, Agrobacterium, and Borrelia) are linear and possess telomeres, which are very different from those of the eukaryotic chromosomes in structure and functions. The known structures of bacterial telomeres take the form of proteins bound to the ends of linear chromosomes, or hairpin loops of single-stranded DNA at the ends of the linear chromosomes.[17]

While replicating DNA, the eukaryotic DNA replication enzymes (the DNA polymerase protein complex) cannot replicate the sequences present at the ends of the chromosomes (or more precisely the chromatid fibres). Hence, these sequences and the information they carry may get lost. This is the reason telomeres are so important in context of successful cell division: They "cap" the end-sequences and themselves get lost in the process of DNA replication. But the cell has an enzyme called telomerase, which carries out the task of adding repetitive nucleotide sequences to the ends of the DNA. Telomerase, thus, "replenishes" the telomere "cap" of the DNA. In most multicellular eukaryotic organisms, telomerase is active only in germ cells, some types of stem cells such as embryonic stem cells, and certain white blood cells. Telomerase can be re activated and telomeres reset back to an embryonic state by somatic cell nuclear transfer.[18] There are theories that claim that the steady shortening of telomeres with each replication in somatic (body) cells may have a role in senescence and in the prevention of cancer. This is because the telomeres act as a sort of time-delay "fuse", eventually running out after a certain number of cell divisions and resulting in the eventual loss of vital genetic information from the cell's chromosome with future divisions.

Telomere length varies greatly between species, from approximately 300 base pairs in yeast[19] to many kilobases in humans, and usually is composed of arrays of guanine-rich, six- to eight-base-pair-long repeats. Eukaryotic telomeres normally terminate with 3′ single-stranded-DNA overhang, which is essential for telomere maintenance and capping. Multiple proteins binding single- and double-stranded telomere DNA have been identified.[20] These function in both telomere maintenance and capping. Telomeres form large loop structures called telomere loops, or T-loops. Here, the single-stranded DNA curls around in a long circle, stabilized by telomere-binding proteins.[21] At the very end of the T-loop, the single-stranded telomere DNA is held onto a region of double-stranded DNA by the telomere strand disrupting the double-helical DNA, and base pairing to one of the two strands. This triple-stranded structure is called a displacement loop or D-loop.[22]

Telomere shortening in humans can induce replicative senescence, which blocks cell division. This mechanism appears to prevent genomic instability and development of cancer in human aged cells by limiting the number of cell divisions. However, shortened telomeres impair immune function that might also increase cancer susceptibility.[23] If telomeres become too short, they have the potential to unfold from their presumed closed structure. The cell may detect this uncapping as DNA damage and then either stop growing, enter cellular old age (senescence), or begin programmed cell self-destruction (apoptosis) depending on the cell's genetic background (p53 status). Uncapped telomeres also result in chromosomal fusions. Since this damage cannot be repaired in normal somatic cells, the cell may even go into apoptosis. Many aging-related diseases are linked to shortened telomeres. Organs deteriorate as more and more of their cells die off or enter cellular senescence.

Shelterin co-ordinates the T-loop formation of telomeres

Shelterin

Main article: Shelterin

At the very distal end of the telomere is a 300 bp single-stranded portion, which forms the T-Loop. This loop is analogous to a knot, which stabilizes the telomere, preventing the telomere ends from being recognized as break points by the DNA repair machinery. Should non-homologous end joining occur at the telomeric ends, chromosomal fusion will result. The T-loop is held together by several proteins, the most notable ones being TRF1, TRF2, POT1, TIN1, and TIN2, collectively referred to as the shelterin complex. In humans, the shelterin complex consists of six proteins identified as TRF1, TRF2, TIN2, POT1, TPP1, and RAP1.[15]

Shortening

Telomeres shorten in part because of the end replication problem that is exhibited during DNA replication in eukaryotes only. Because DNA replication does not begin at either end of the DNA strand, but starts in the center, and considering that all known DNA polymerases move in the 5' to 3' direction, one finds a leading and a lagging strand on the DNA molecule being replicated.

On the leading strand, DNA polymerase can make a complementary DNA strand without any difficulty because it goes from 5' to 3'. However, there is a problem going in the other direction on the lagging strand. To counter this, short sequences of RNA acting as primers attach to the lagging strand a short distance ahead of where the initiation site was. The DNA polymerase can start replication at that point and go to the end of the initiation site. This causes the formation of Okazaki fragments. More RNA primers attach further on the DNA strand and DNA polymerase comes along and continues to make a new DNA strand.

Lagging strand during DNA replication

Eventually, the last RNA primer attaches, and DNA polymerase, RNA nuclease, and DNA ligase come along to convert the RNA (of the primers) to DNA and to seal the gaps in between the Okazaki fragments. But, in order to change RNA to DNA, there must be another DNA strand in front of the RNA primer. This happens at all the sites of the lagging strand, but it does not happen at the end where the last RNA primer is attached. Ultimately, that RNA is destroyed by enzymes that degrade any RNA left on the DNA. Thus, a section of the telomere is lost during each cycle of replication at the 5' end of the lagging strand's daughter.

However, test-tube studies have shown that telomeres are highly susceptible to oxidative stress. There is evidence that oxidative stress-mediated DNA damage is an important determinant of telomere shortening.[24] Telomere shortening due to free radicals explains the difference between the estimated loss per division because of the end-replication problem (c. 20 bp) and actual telomere shortening rates (50–100 bp), and has a greater absolute impact on telomere length than shortening caused by the end-replication problem. Population-based studies have also indicated an interaction between anti-oxidant intake and telomere length. In the Long Island Breast Cancer Study Project (LIBCSP), authors found a moderate increase in breast cancer risk among women with the shortest telomeres and lower dietary intake of beta carotene, vitamin C or E.[25] These results suggest that cancer risk due to telomere shortening may interact with other mechanisms of DNA damage, specifically oxidative stress.

Telomere shortening is associated with aging, mortality and aging-related diseases. In 2003, Richard Cawthon discovered that those with longer telomeres lead longer lives than those with short telomeres.[26] However, it is not known whether short telomeres are just a sign of cellular age or actually contribute to the aging process.

Lengthening

The average cell will divide between 50 and 70 times before cell death. As the cell divides the telomeres on the end of the chromosome get smaller. The Hayflick limit is the theoretical limit to the number of times a cell may divide until the telomere becomes so short that division is inhibited and the cell enters senescence.

The phenomenon of limited cellular division was first observed by Leonard Hayflick, and is now referred to as the Hayflick limit.[27][28] Significant discoveries were subsequently made by a group of scientists organized at Geron Corporation by Geron's founder Michael D. West that tied telomere shortening with the Hayflick limit.[29] The cloning of the catalytic component of telomerase enabled experiments to test whether the expression of telomerase at levels sufficient to prevent telomere shortening was capable of immortalizing human cells. Telomerase was demonstrated in a 1998 publication in Science to be capable of extending cell lifespan, and now is well-recognized as capable of immortalizing human somatic cells.[30]

It is becoming apparent that reversing shortening of telomeres through temporary activation of telomerase may be a potent means to slow aging. The reason that this would extend human life is because it would extend the Hayflick limit. Three routes have been proposed to reverse telomere shortening: drugs, gene therapy, or metabolic suppression, so-called, torpor/hibernation. So far these ideas have not been proven in humans, but it has been demonstrated that telomere shortening is reversed in hibernation and aging is slowed (Turbill, et al. 2012 & 2013) and that hibernation prolongs life-span (Lyman et al. 1981). It has also been demonstrated that telomere extension has successfully reversed some signs of aging in laboratory mice [31][32] and the nematode worm species Caenorhabditis elegans.[33] It has been hypothesized that longer telomeres and especially telomerase activation might cause increased cancer (e.g. Weinstein and Ciszek, 2002). However, longer telomeres might also protect against cancer, because short telomeres are associated with cancer. It has also been suggested that longer telomeres might cause increased energy consumption.[23]

Techniques to extend telomeres could be useful for tissue engineering, because they might permit healthy, noncancerous mammalian cells to be cultured in amounts large enough to be engineering materials for biomedical repairs.

Two recent studies on long-lived seabirds demonstrate that the role of telomeres is far from being understood. In 2003, scientists observed that the telomeres of Leach's storm-petrel (Oceanodroma leucorhoa) seem to lengthen with chronological age, the first observed instance of such behaviour of telomeres.[34] In 2006, Juola et al.[35] reported that in another unrelated, long-lived seabird species, the great frigatebird (Fregata minor), telomere length did decrease until at least c.40 years of age (i.e. probably over the entire lifespan), but the speed of decrease slowed down massively with increasing ages, and that rates of telomere length decrease varied strongly between individual birds. They concluded that in this species (and probably in frigatebirds and their relatives in general), telomere length could not be used to determine a bird's age sufficiently well. Thus, it seems that there is much more variation in the behavior of telomere length than initially believed.

Furthermore, Gomes et al. found, in a study of the comparative biology of mammalian telomeres, that telomere length of different mammalian species correlates inversely, rather than directly, with lifespan, and they concluded that the contribution of telomere length to lifespan remains controversial.[36] Harris et al. found little evidence that, in humans, telomere length is a significant biomarker of normal aging with respect to important cognitive and physical abilities.[37] Gilley and Blackburn tested whether cellular senescence in paramecium is caused by telomere shortening, and found that telomeres were not shortened during senescence.[38]

Exercise-induced lengthening

A 2013 pilot study from UCSF took 35 men with localized early-stage prostate cancer and had 10 of them begin "lifestyle changes that included: a plant-based diet (high in fruits, vegetables and unrefined grains, and low in fat and refined carbohydrates); moderate exercise (walking 30 minutes a day, six days a week); stress reduction (gentle yoga-based stretching, breathing, meditation)" and also "weekly group support". When compared to the other 25 study participants, "The group that made the lifestyle changes experienced a 'significant' increase in telomere length of approximately 10 percent. Further, the more people changed their behavior by adhering to the recommended lifestyle program, the more dramatic their improvements in telomere length."[39] A 2014 study entitled "Stand up for health—avoiding sedentary behaviour might lengthen your telomeres: secondary outcomes from a physical activity RCT in older people" indicated somewhat contradictory results, stating, "In the intervention group, there was a negative correlation between changes in time spent exercising and changes in telomere length (rho=-0.39, p=0.07). On the other hand, in the intervention group, telomere lengthening was significantly associated with reduced sitting time (rho=-0.68, p=0.02).[40]

Sequences

Known, up-to-date telomere nucleotide sequences are listed in Telomerase Database website.

Some known telomere nucleotide sequences
Group Organism Telomeric repeat (5' to 3' toward the end)
Vertebrates Human, mouse, Xenopus TTAGGG
Filamentous fungi Neurospora crassa TTAGGG
Slime moulds Physarum, Didymium TTAGGG
Dictyostelium AG(1-8)
Kinetoplastid protozoa Trypanosoma, Crithidia TTAGGG
Ciliate protozoa Tetrahymena, Glaucoma TTGGGG
Paramecium TTGGG(T/G)
Oxytricha, Stylonychia, Euplotes TTTTGGGG
Apicomplexan protozoa Plasmodium TTAGGG(T/C)
Higher plants Arabidopsis thaliana TTTAGGG
Cestrum elegans TTTTTTAGGG[41]
Allium CTCGGTTATGGG[42]
Green algae Chlamydomonas TTTTAGGG
Insects Bombyx mori TTAGG
Roundworms Ascaris lumbricoides TTAGGC
Fission yeasts Schizosaccharomyces pombe TTAC(A)(C)G(1-8)
Budding yeasts Saccharomyces cerevisiae TGTGGGTGTGGTG (from RNA template)
or G(2-3)(TG)(1-6)T (consensus)
Saccharomyces castellii TCTGGGTG
Candida glabrata GGGGTCTGGGTGCTG
Candida albicans GGTGTACGGATGTCTAACTTCTT
Candida tropicalis GGTGTA[C/A]GGATGTCACGATCATT
Candida maltosa GGTGTACGGATGCAGACTCGCTT
Candida guillermondii GGTGTAC
Candida pseudotropicalis GGTGTACGGATTTGATTAGTTATGT
Kluyveromyces lactis GGTGTACGGATTTGATTAGGTATGT

Cancer

Telomeres are critical for maintaining genomic integrity and studies show that telomere dysfunction or shortening is commonly acquired during the process of tumor development.[43] Short telomeres can lead to genomic instability, chromosome loss and the formation of non-reciprocal translocations; and telomeres in tumor cells and their precursor lesions are significantly shorter than surrounding normal tissue.[44][45]

Observational studies have found shortened telomeres in many cancers: including pancreatic, bone, prostate, bladder, lung, kidney, and head and neck. In addition, people with many types of cancer have been found to possess shorter leukocyte telomeres than healthy controls.[46] Recent meta-analyses suggest 1.4 to 3.0 fold increased risk of cancer for those with the shortest vs. longest telomeres.[47][48] However the increase in risk varies by age, sex, tumor type and differences in lifestyle factors.

Some of the same lifestyle factors which increase risk of developing cancer have also been associated with shortened telomeres: including stress, smoking, physical inactivity and diet high in refined sugars [48] Diet and physical activity influence inflammation and oxidative stress. These factors are thought to influence telomere maintenance.[49] Psychologic stress has also been linked to accelerated cell aging, as reflected by decreased telomerase activity and short telomeres.[50] It has been suggested that a combination of lifestyle modifications, including healthy diet, exercise and stress reduction, have the potential to increase telomere length, reverse cellular aging, and reduce the risk for aging-related diseases. In a recent clinical trial for early-stage prostate cancer patients, comprehensive lifestyle changes resulted in a short-term increase in telomerase activity and long-term modification in telomere length.[51][52] Lifestyle modifications have the potential to naturally regulate telomere maintenance without promoting tumorigenesis, as traditional mechanisms of telomere lengthening involve the use of telomerase activating agents.

Cancer cells require a mechanism to maintain their telomeric DNA in order to continue dividing indefinitely (immortalization). A mechanism for telomere elongation or maintenance is one of the key steps in cellular immortalization and can be used as a diagnostic marker in the clinic. Telomerase, the enzyme complex responsible for elongating telomeres through the addition of telomere repeats to the ends of chromosomes, is activated in approximately 80% of tumors.[53] However, a sizeable fraction of cancerous cells employ alternative lengthening of telomeres (ALT),[54] a non-conservative telomere lengthening pathway involving the transfer of telomere tandem repeats between sister-chromatids.[55]

Telomerase and cancer

Telomerase is the natural enzyme that promotes telomere lengthening. It is active in stem cells, germ cells, hair follicles, and 90 percent of cancer cells, but its expression is low or absent in somatic cells. Telomerase functions by adding bases to the ends of the telomeres. Cells with sufficient telomerase activity are considered immortal in the sense that they can divide past the Hayflick limit without entering senescence or apoptosis. For this reason, telomerase is viewed as a potential target for anti-cancer drugs (such as Geron's Imetelstat currently in human clinical trials and telomestatin).[56]

Studies using knockout mice have demonstrated that the role of telomeres in cancer can both be limiting to tumor growth, as well as promote tumorigenesis, depending on the cell type and genomic context.[57][58]

Telomerase is a "ribonucleoprotein complex" composed of a protein component and an RNA primer sequence that acts to protect the terminal ends of chromosomes from being broken down by enzymes. The telomeres (and the actions of telomerase) are necessary because, during replication, DNA polymerase can synthesize DNA in only a 5' to 3' direction (each DNA strand having a polarity that is determined by the precise manner in which sugar molecules of the strand's "backbone" are linked together) and can do so only by adding nucleotides to RNA primers (that have already been placed at various points along the length of the DNA). The RNA strands are replaced with newly synthesized DNA, but DNA polymerase can only "backfill" deoxyribonucleotides if there is already DNA "upstream" from (i.e., located 5' to) the RNA primer. At the chromosome terminal, however, there is no nucleotide sequence in the 5' direction (and therefore no upstream RNA primer or DNA), so DNA polymerase cannot function and genetic sequence might be lost through chromosomal fraying. Chromosomal ends might also be processed as breaks in double-strand DNA with chromosome-to-chromosome telomere fusions resulting.

Telomeres at the end of DNA prevent the chromosome from growing shorter during replications (with loss of genetic information) by employing "telomerases" to synthesize DNA at the chromosome terminal. These include a protein subgroup of specialized reverse transcriptase enzymes known as TERT (telomerase reverse transcriptases) and are involved in synthesis of telomeres in humans and many other, but not all, organisms. Because DNA replication mechanisms are affected by oxidative stress and because TERT expression is very low in most types of human cell, telomeres shorten every time a cell divides. Among cell types characterized by extensive cell division (such as stem cells and certain white blood cells), however, TERT is expressed at higher levels and telomere shortening is partially or fully prevented.

In addition to its TERT protein component, telomerase also contains a piece of template RNA known as the TERC (telomerase RNA component) or TR (telomerase RNA). In humans, this TERC telomere sequence is a repeating string of TTAGGG, between 3 and 20 kilobases in length. There are an additional 100-300 kilobases of telomere-associated repeats between the telomere and the rest of the chromosome. Telomere sequences vary from species to species, but, in general, one strand is rich in G with fewer Cs. These G-rich sequences can form four-stranded structures (G-quadruplexes), with sets of four bases held in plane and then stacked on top of each other, with either a sodium or a potassium ion between the planar quadruplexes.

Mammalian (and other) somatic cells without telomerase gradually lose telomeric sequences as a result of incomplete replication (Counter et al., 1992). As mammalian telomeres shorten, eventually cells reach their replicative limit and progress into senescence or old age. Senescence involves p53 and pRb pathways and leads to the halting of cell proliferation (Campisi, 2005). Senescence may play an important role in suppression of cancer emergence, although inheriting shorter telomeres probably does not protect against cancer.[23] With critically shortened telomeres, further cell proliferation can be achieved by inactivation of p53 and pRb pathways. Cells entering proliferation after inactivation of p53 and pRb pathways undergo crisis. Crisis is characterized by gross chromosomal rearrangements and genome instability, and almost all cells die.

ALT (Alternative Lengthening of Telomeres) and cancer

About 5–10% of human cancers activate the alternative lengthening of telomeres (ALT) pathway, which relies on recombination-mediated elongation.[59] Rarely, cells emerge from crisis immortalized through telomere lengthening by either activated telomerase or ALT (Colgina and Reddel, 1999; Reddel and Bryan, 2003). The first description of an ALT cell line demonstrated that their telomeres are highly heterogeneous in length and predicted a mechanism involving recombination (Murnane et al., 1994). Subsequent studies have confirmed a role for recombination in telomere maintenance by ALT (Dunham et al., 2000), however the exact mechanism of this pathway is yet to be determined. ALT cells produce abundant T-circles, possible products of intratelomeric recombination and T-loop resolution (Tomaska et al., 2000; 2009; Cesare and Griffith, 2004; Wang et al., 2004).

Evolutionary aspects

Since shorter telomeres are thought by some to be a cause of aging, this raises the question of why longer telomeres are not selected for to ameliorate these effects. A prominent explanation suggests that inheriting longer telomeres would cause increased cancer rates (e.g. Weinstein and Ciszek, 2002). However, a recent literature review and analysis [23] suggests this is unlikely, because shorter telomeres and telomerase inactivation is more often associated with increased cancer rates, and the mortality from cancer occurs late in life when the force of natural selection is very low. An alternative explanation to the hypothesis that long telomeres are selected against due to their cancer promoting effects is the "thrifty telomere" hypothesis, which suggests that the cellular proliferation effects of longer telomeres causes increased energy expenditures.[23] In environments of energetic limitation, shorter telomeres might be an energy sparing mechanism.

Relation to breast cancer

In a healthy female breast, a proportion of cells called luminal progenitors that line the milk ducts have proliferative and differentiation potential and most of them contain critically short telomeres with DNA damage foci. These cells are believed to be the possible common cellular loci where cancers of the breast involving telomere dysregulation may arise.[60] The telomere shortening in these progenitors is not age dependent but is speculated to be basal to luminal epithelial differentiation program-dependent. Also, the telomerase activity is unusually high in these cells when isolated from younger women, but declines with age.[61]

Measurement

Several techniques are currently employed to assess average telomere length in eukaryotic cells. One method is the Terminal Restriction Fragment (TRF) southern blot,[62] which involves hybridization of a radioactive 32P-(TTAGGG)n oligonucleotide probe to Hinf / Rsa I digested genomic DNA embedded on a nylon membrane and subsequently exposed to autoradiographic film or phosphoimager screen. Another histochemical method, termed Q-FISH, involves fluorescent in situ hybridization (FISH).[63] Q-FISH, however, requires significant amounts of genomic DNA (2-20 micrograms) and labor that renders its use limited in large epidemiological studies. Some of these impediments have been overcome with a Real-Time PCR assay for telomere length and Flow-FISH. Real-time PCR assay involves determining the Telomere-to-Single Copy Gene (T/S)ratio,[64] which is demonstrated to be proportional to the average telomere length in a cell.

Another technique, referred to as single telomere elongation length analysis (STELA), was developed in 2003 by Duncan Baird. This technique allows investigations that can target specific telomere ends, which is not possible with TRF analysis. However, due to this technique's being PCR-based, telomeres larger than 25Kb cannot be amplified and there is a bias towards shorter telomeres.

While multiple companies offer telomere length measurement services,[65][66][67] the utility of these measurements for widespread clinical or personal use has been questioned by prominent scientists without financial interests in these companies.[68][69] Nobel Prize winner Elizabeth Blackburn, who was the co-founder of one of these companies and has prominently promoted the clinical utility of telomere length measures,[70] resigned from the company in June 2013 "owing to an impending change in the control of Telome Health".[71]

The opening track of the 2016 album, Curve of the Earth, by the UK, indie rock band, Mystery Jets, is named Telomere and contains the following stanza:

In the telomere that lives inside us
And the people walking down below
Crawling home alone like spiders
As the cancer slowly starts to grow

.[72]

See also

References

  1. ↑ Sadava, D., Hillis, D., Heller, C., & Berenbaum, M. (2011). Life: The science of biology. (9th ed.) Sunderland, MA: Sinauer Associates Inc.
  2. ↑ Okuda K, Bardeguez A, Gardner JP, Rodriguez P, Ganesh V, Kimura M, Skurnick J, Awad G, Aviv A (2002). "Telomere length in the newborn" (PDF). Pediatric Research. 52 (3): 377–381. PMID 12193671.
  3. ↑ Arai Y, Martin-Ruiz CM, Takayama M, Abe Y, Takebayashi T, Koyasu S, Suematsu M, Hirose N, von Zglinicki T (2015). "Inflammation, But Not Telomere Length, Predicts Successful Ageing at Extreme Old Age: A Longitudinal Study of Semi-supercentenarians". EBioMedicine. 2 (10): 1549–1548. doi:10.1016/j.ebiom.2015.07.029. PMC 4634197Freely accessible. PMID 26629551.
  4. ↑ Dalgård C, Benetos A, Verhulst S, Labat C, Kark JD, Christensen K, Kimura M, Kyvik KO, Aviv A (2015). "Leukocyte telomere length dynamics in women and men: menopause vs age effects". International Journal of Epidemiology. 44 (5): 1688–1695. doi:10.1093/ije/dyv165. PMC 4681111Freely accessible. PMID 26385867.
  5. ↑ Talks at Google (20 August 2008). "Dr. Elizabeth Blackburn - Talks at Google" – via YouTube.
  6. ↑ Passarge, Eberhard. Color atlas of genetics, 2007.
  7. ↑ Olovnikov, Alexei M. (1971). Принцип маргинотомии в матричном синтезе полинуклеотидов [Principle of marginotomy in template synthesis of polynucleotides]. Doklady Akademii Nauk SSSR (in Russian). 201 (6): 1496–9. PMID 5158754.
  8. ↑ Olovnikov AM (September 1973). "A theory of marginotomy. The incomplete copying of template margin in enzymic synthesis of polynucleotides and biological significance of the phenomenon". J. Theor. Biol. 41 (1): 181–90. doi:10.1016/0022-5193(73)90198-7. PMID 4754905.
  9. ↑ "No Nobel physiology and medicine award for Russian gerontologist Aleksey Olovnikov". Telegraph. October 21, 2009.
  10. ↑ Blackburn AM; Gall, Joseph G. (March 1978). "A tandemly repeated sequence at the termini of the extrachromosomal ribosomal RNA genes in Tetrahymena". J. Mol. Biol. 120 (1): 33–53. doi:10.1016/0022-2836(78)90294-2. PMID 642006.
  11. ↑ "The 2009 Nobel Prize in Physiology or Medicine - Press Release". Nobelprize.org. 2009-10-05. Retrieved 2012-06-12.
  12. ↑ Harrison's Principles of Internal Medicine, Ch. 69, Cancer cell biology and angiogenesis, Robert G. Fenton and Dan L. Longo, p. 454.
  13. ↑ "Portfolio".
  14. ↑ "Unravelling the secret of ageing". COSMOS: The Science of Everything. October 5, 2009. Archived from the original on January 14, 2015.
  15. 1 2 Blasco, Maria; Paula Martínez (21 Jun 2010). "Role of shelterin in cancer and aging". Aging Cell. 9 (5): 653–666. doi:10.1111/j.1474-9726.2010.00596.x. PMID 20569239.
  16. ↑ Lundblad, 2000; Ferreira et al., 2004
  17. ↑ Maloy, Stanley (July 12, 2002). "Bacterial Chromosome Structure". Retrieved 2008-06-22.
  18. ↑ Robert P. Lanza, Jose B. Cibelli, Catherine Blackwell, Vincent J. Cristofalo, Mary Kay Francis, Gabriela M. Baerlocher, Jennifer Mak, Michael Schertzer, Elizabeth A. Chavez, Nancy Sawyer, Peter M. Lansdorp, Michael D. West1 (28 April 2000). "Extension of Cell Life-Span and Telomere Length in Animals Cloned from Senescent Somatic Cells" (PDF). Science.
  19. ↑ Shampay , Szostak J.W., Blackburn E.H.; Szostak; Blackburn (1984). "DNA sequences of telomeres maintained in yeast". Nature. 310 (5973): 154–157. doi:10.1038/310154a0. PMID 6330571.
  20. ↑ "Characterization of the yeast telomere nucleoprotein core: Rap1 binds independently to each recognition site". J. Biol. Chem. 285: 35814–24. 2010. doi:10.1074/jbc.M110.170167. PMC 2975205Freely accessible. PMID 20826803.
  21. ↑ Griffith J, Comeau L, Rosenfield S, Stansel R, Bianchi A, Moss H, de Lange T; Comeau; Rosenfield; Stansel; Bianchi; Moss; De Lange (1999). "Mammalian telomeres end in a large duplex loop". Cell. 97 (4): 503–14. doi:10.1016/S0092-8674(00)80760-6. PMID 10338214.
  22. ↑ Burge S, Parkinson G, Hazel P, Todd A, Neidle S; Parkinson; Hazel; Todd; Neidle (2006). "Quadruplex DNA: sequence, topology and structure". Nucleic Acids Res. 34 (19): 5402–15. doi:10.1093/nar/gkl655. PMC 1636468Freely accessible. PMID 17012276.
  23. 1 2 3 4 5 Eisenberg DTA (2011). "An evolutionary review of human telomere biology: The thrifty telomere hypothesis and notes on potential adaptive paternal effects". American Journal of Human Biology. 23 (2): 149–167. doi:10.1002/ajhb.21127. PMID 21319244.
  24. ↑ Richter, T; von Zglinicki, T (2007). "A continuous correlation between oxidative stress and telomere shortening in fibroblasts". Exp Gerontol. 42 (11): 1039–1042. doi:10.1016/j.exger.2007.08.005. PMID 17869047.
  25. ↑ Shen, J; Gammon, MD; Terry, MB; Wang, Q; Bradshaw, P; Teitelbaum, SL; Neugut, AI; Santella, RM (Apr 2009). "Telomere length, oxidative damage, antioxidants and breast cancer risk". Int J Cancer. 124 (7): 1637–43. doi:10.1002/ijc.24105.
  26. ↑ Cawthon, RM; Smith, KR; O'Brien, E; Sivatchenko, A; Kerber, RA (2003). "Association between telomere length in blood and mortality in people aged 60 years or older". Lancet. 361 (9355): 393–395. doi:10.1016/s0140-6736(03)12384-7.
  27. ↑ Hayflick L, Moorhead PS; Moorhead (1961). "The serial cultivation of human diploid cell strains". Exp Cell Res. 25 (3): 585–621. doi:10.1016/0014-4827(61)90192-6. PMID 13905658.
  28. ↑ Hayflick L. (1965). "The limited in vitro lifetime of human diploid cell strains". Exp. Cell Res. 37 (3): 614–636. doi:10.1016/0014-4827(65)90211-9. PMID 14315085.
  29. ↑ Feng J, Funk WD, Wang SS, Weinrich SL, Avilion AA, Chiu CP, Adams RR, Chang E, Allsopp RC, Yu J; Funk; Wang; Weinrich; Avilion; Chiu; Adams; Chang; Allsopp; Yu (September 1995). "The RNA component of human telomerase". Science. 269 (5228): 1236–41. doi:10.1126/science.7544491. PMID 7544491.
  30. ↑ Bodnar, A.G.; Ouellette, M.; Frolkis, M.; Holt, S.E.; Chiu, C.P.; Morin, G.B.; Harley, C.B.; Shay, J.W.; Lichtsteiner, S.; Wright, W.E. (1998). "Extension of life-span by introduction of telomerase into normal human cells". Science. 279 (5349): 349–352. doi:10.1126/science.279.5349.349.
  31. ↑ Sample, Ian (November 28, 2010). "Harvard scientists reverse the ageing process in mice – now for humans". The Guardian. London.
  32. ↑ Jaskelioff, Mariela; Muller, Florian L.; Paik, Ji-Hye; Thomas, Emily; Jiang, Shan; Adams, Andrew C.; Sahin, Ergun; Kost-Alimova, Maria; Protopopov, Alexei; Cadiñanos, Juan; Horner, James W.; Maratos-Flier, Eleftheria; DePinho, Ronald A. (6 January 2011). "Telomerase reactivation reverses tissue degeneration in aged telomerase-deficient mice". Nature. 469 (7328): 102–106. doi:10.1038/nature09603. PMC 3057569Freely accessible. PMID 21113150 – via www.nature.com.
  33. ↑ Joeng KS, Song EJ, Lee KJ, Lee J; Song; Lee; Lee (2004). "Long lifespan in worms with long telomeric DNA". Nature Genetics. 36 (6): 607–11. doi:10.1038/ng1356. PMID 15122256.
  34. ↑ Nakagawa S, Gemmell NJ, Burke T; Gemmell; Burke (September 2004). "Measuring vertebrate telomeres: applications and limitations". Mol. Ecol. 13 (9): 2523–33. doi:10.1111/j.1365-294X.2004.02291.x. PMID 15315667.
  35. ↑ Juola, Frans A; Haussmann, Mark F; Dearborn, Donald C; Vleck, Carol M (2006). "Telomere shortening in a long-lived marine bird: Cross-sectional analysis and test of an aging tool". The Auk. 123 (3): 775. doi:10.1642/0004-8038(2006)123[775:TSIALM]2.0.CO;2. ISSN 0004-8038.
  36. ↑ Gomes, NM; Ryder, OA; Houck, ML; Charter, SJ; Walker, W; Forsyth, NR; Austad, SN; Venditti, C; Pagel, M; Shay, JW; Wright, WE (2011). "Comparative biology of mammalian telomeres: hypotheses on ancestral states and the roles of telomeres in longevity determination". Aging Cell. 10 (5): 761–768. doi:10.1111/j.1474-9726.2011.00718.x. PMC 3387546Freely accessible. PMID 21518243.
  37. ↑ Harris, SE; Martin-Ruiz, C; von Zglinicki, T; Starr, JM; Deary, IJ (2010). "Telomere length and aging biomarkers in 70-year-olds: the Lothian Birth Cohort 1936". Neurobiol Aging. 33 (7): 1486.e3–1486.e8. doi:10.1016/j.neurobiolaging.2010.11.013. PMID 21194798.
  38. ↑ Gilley, D; Blackburn, EH (1994). "Lack of telomere shortening during senescence in Paramecium". Proc Natl Acad Sci U S A. 91 (5): 1955–1958. doi:10.1073/pnas.91.5.1955. PMID 8127914.
  39. ↑ Fernandez, Elizabeth (2013-09-16). "Lifestyle Changes May Lengthen Telomeres, A Measure of Cell Aging". http://www.ucsf.edu/. University of California, San Francisco. Retrieved 2015-03-16. External link in |website= (help)
  40. ↑ Sjögren, P; Fisher, R; Kallings, L; Svenson, U; Roos, G; Hellénius, M (2014-09-03). "Stand up for health--avoiding sedentary behaviour might lengthen your telomeres: secondary outcomes from a physical activity RCT in older people.". Br J Sports Med. 48: 1407–9. doi:10.1136/bjsports-2013-093342. PMID 25185586.
  41. ↑ Peška, Vratislav; Fajkus, Petr; Fojtová, Miloslava; Dvořáčková, Martina; Hapala, Jan; Dvořáček, Vojtěch; Polanská, Pavla; Leitch, Andrew R.; Sýkorová, Eva; Fajkus, Jiří (May 2015). "Characterisation of an unusual telomere motif (TTTTTTAGGG) in the plant (Solanaceae), a species with a large genome". The Plant Journal. 82 (4): 644–654. doi:10.1111/tpj.12839.
  42. ↑ Fajkus, Petr; Peška, Vratislav; Sitová, Zdeňka; Fulnečková, Jana; Dvořáčková, Martina; Gogela, Roman; Sýkorová, Eva; Hapala, Jan; Fajkus, Jiří (2016). "Allium telomeres unmasked: the unusual telomeric sequence (CTCGGTTATGGG)n is synthesized by telomerase". The Plant Journal. 85 (3): 337–347. doi:10.1111/tpj.13115.
  43. ↑ Raynaud, CM; Sabatier, L; Philipot, O; Olaussen, KA; Soria, JC (2008). "Telomere length, telomeric proteins and genomic instability during the multistep carcinogenic process". Crit Rev Oncol Hematol. 66: 99–117. doi:10.1016/j.critrevonc.2007.11.006.
  44. ↑ Blasco, MA; Lee, HW; Hande, MP; Samper, E; Lansdorp, PM; et al. (1997). "Telomere shortening and tumor formation by mouse cells lacking telomerase RNA". Cell. 91 (1): 25–34. doi:10.1016/s0092-8674(01)80006-4.
  45. ↑ Artandi, SE; Chang, S; Lee, SL; Alson, S; Gottlieb, GJ; et al. (2000). "Telomere dysfunction promotes non-reciprocal translocations and epithelial cancers in mice". Nature. 406: 641–645. doi:10.1038/35020592.
  46. ↑ Willeit Peter, Willeit Johann, Mayr Anita, Weger Siegfried, Oberhollenzer Friedrich, Brandstätter Anita, Kronenberg Florian, Kiechl Stefan; Willeit; Mayr; Weger; Oberhollenzer; Brandstätter; Kronenberg; Kiechl (2010). "Telomere length and risk of incident cancer and cancer mortality". JAMA. 304 (1): 69–75. doi:10.1001/jama.2010.897. PMID 20606151.
  47. ↑ Ma, H; Zhou, Z; Wei, S; et al. (2011). "Shortened telomere length is associated with increased risk of cancer: a meta-analysis". PLOS ONE. 6 (6): e20466. doi:10.1371/journal.pone.0020466.
  48. 1 2 Wentzensen, IM; Mirabello, L; Pfeiffer, RM; Savage, SA (2011). "The association of telomere length and cancer: a meta-analysis". Cancer Epidemiol Biomarkers Prev. 20 (6): 1238–1250. doi:10.1158/1055-9965.epi-11-0005.
  49. ↑ Paul, L (Oct 2011). "Diet, nutrition and telomere length". J Nurt Biochem. 22 (10): 895–901. doi:10.1016/j.jnutbio.2010.12.001.
  50. ↑ Epel, ES; Lin, J; Wilhelm, FH; Wolkowitz, OM; Cawthon, R; Adler, NE; Dolbier, C; Mendes, WB; Blackburn, EH (April 2006). "Cell aging in relation to stress arousal and cardiovascular disease risk factors". Psychoneuroendocrinology. 31 (3): 277–87. doi:10.1016/j.psyneuen.2005.08.011.
  51. ↑ Ornish, D; Lin, J; Chan, JM; Epel, E; Kemp, C; Weidner, G; Marlin, R; Frenda, SJ; Magbanua, MJ; Daubenmier, J; Estay, I; Hills, NK; Chainani-Wu, N; Carroll, PR; Blackburn, EH (Oct 2013). "Effect of comprehensive lifestyle changes on telomerase activity and telomerelength in men with biopsy-proven low-risk prostate cancer: 5-year follow-up of a descriptive pilot study". Lancet Oncol. 14 (11): 1112–20. doi:10.1016/S1470-2045(13)70366-8.
  52. ↑ Ornish, D; Lin, J; Daubenmier, J; Weidner, G; Epel, E; Kemp, C; Magbanua, MJ; Marlin, R; Yglecias, L; Carroll, PR; Blackburn, EH (Nov 2008). "Increased telomerase activity and comprehensive lifestyle changes: a pilot study". Lancet Oncol. 9 (11): 1048–57. doi:10.1016/S1470-2045(08)70234-1.
  53. ↑ Aschacher; Wolf; Enzmann; Kienzl (2015). "ALINE-1 induces hTERT and ensures telomere maintenance in tumour cell lines". Oncogene. doi:10.1038/onc.2015.65.
  54. ↑ Henson JD, Neumann AA, Yeager TR, Reddel RR; Neumann; Yeager; Reddel (2002). "Alternative lengthening of telomeres in mammalian cells". Oncogene. 21 (4): 598–610. doi:10.1038/sj.onc.1205058. PMID 11850785.
  55. ↑ Chris Molenaar; Karien Wiesmeijer; Nico P. Verwoerd; Shadi Khazen; Roland Eils; Hans J. Tanke & Roeland W. Dirks (2003-12-15). "Visualizing telomere dynamics in living mammalian cells using PNA probes". The EMBO Journal. The European Molecular Biology Organization. 22 (24): 6631–6641. doi:10.1093/emboj/cdg633. PMC 291828Freely accessible. PMID 14657034.
  56. ↑ Philippi C, Loretz B, Schaefer UF, Lehr CM.; Loretz; Schaefer; Lehr (April 2010). "Telomerase as an emerging target to fight cancer - Opportunities and challenges for nanomedicine". Journal of Controlled Release. 146 (2): 228–40. doi:10.1016/j.jconrel.2010.03.025. PMID 20381558.
  57. ↑ Chin L, Artandi SE, Shen Q, et al. (May 1999). "p53 deficiency rescues the adverse effects of telomere loss and cooperates with telomere dysfunction to accelerate carcinogenesis". Cell. 97 (4): 527–38. doi:10.1016/S0092-8674(00)80762-X. PMID 10338216.
  58. ↑ Greenberg RA, Chin L, Femino A, et al. (May 1999). "Short dysfunctional telomeres impair tumorigenesis in the INK4a(delta2/3) cancer-prone mouse". Cell. 97 (4): 515–25. doi:10.1016/S0092-8674(00)80761-8. PMID 10338215.
  59. ↑ Henson, JD; Neumann, AA; Yeager, TR; Reddel, RR (2002). "Alternative lengthening of telomeres in mammalian cells". Oncogene. 21 (4): 598–610. doi:10.1038/sj.onc.1205058. PMID 11850785.
  60. ↑ BBC, World/Mundo. "Resuelven misterio sobre el origen del cáncer de mama".
  61. ↑ Kannan, Nagarajan; Nazmul Huda, LiRen Tu, Radina Droumeva, Geraldine Aubert, Elizabeth Chavez, Ryan R. Brinkman, Peter Lansdorp, Joanne Emerman, Satoshi Abe, Connie Eaves, David Gilley (4 June 2013). "The Luminal Progenitor Compartment of the Normal Human Mammary Gland Constitutes a Unique Site of Telomere Dysfunction". Stem Cell Reports. 1 (1): 28–31. doi:10.1016/j.stemcr.2013.04.003. PMID 24052939.
  62. ↑ Allshire RC; et al. (1989). "Human telomeres contain at least three types of G-rich repeat distributed non-randomly". Nucleic Acids Res. 17 (12): 4611–4627. doi:10.1093/nar/17.12.4611. PMC 318019Freely accessible. PMID 2664709.
  63. ↑ Rufer N; et al. (1998). "Telomere length dynamics in human lymphocyte subpopulations measured by flow cytometry". Nat Biotechnol. 16 (8): 743–747. doi:10.1038/nbt0898-743. PMID 9702772.
  64. ↑ Cawthon, RM (2002). "Telomere measurement by quantitative PCR". Nucleic Acids Research. 30 (10): e47. doi:10.1093/nar/30.10.e47. PMC 115301Freely accessible. PMID 12000852.
  65. ↑ "Titanovo, Inc". Titanovo.com. Retrieved 2015-04-15.
  66. ↑ "Telome Health, Inc". Telomehealth.com. Retrieved 2013-07-13.
  67. ↑ "TeloMe Home". Telome.com. Retrieved 2013-07-13.
  68. ↑ "A Blood Test Offers Clues to Longevity".
  69. ↑ Zglinicki, T. v. (13 March 2012). "Will your telomeres tell your future?" (PDF). BMJ. 344 (mar13 1): e1727–e1727. doi:10.1136/bmj.e1727.
  70. ↑ Jo Marchant. "Spit test offers guide to health : Nature News". Nature.com. Retrieved 2013-07-13.
  71. ↑ "Elizabeth Blackburn calls time on 'fountain of youth' firm Telome Health".
  72. ↑ "Telomere Lyrics".

Further reading

Wikimedia Commons has media related to Telomeres.
This article is issued from Wikipedia - version of the 11/30/2016. The text is available under the Creative Commons Attribution/Share Alike but additional terms may apply for the media files.